Pack Place Sign Generator.

Generate your own Pack Place Sign.



[ Pack Place Sign Generator ]

Color Scheme Generator.

While designing web pages, computer applications, or house interiors, we need to find a good color scheme. For every tint there are colors which it can coexist with, and which it can't. Some combinations are uncomfortable, or disturbing - while others are pleasant.

This application generates color schemes of several types. Every scheme is based on one base color, which is supplemented with additional colors making together the best optical impression.

[ Color Scheme Generator ]

Here's [ another ] one.

Buzzword Generator.

Some buzzwords:

forceful incremental capability,
nonstationary strict time-phase,
accelerated anolog concept.

[ Buzzword Generator ]

Spammer Name Generator.

If you're an up-and-coming generic V1agra salesman, you've got to have the right name. Nobody would buy penile superpower drugs from a salesman who openly cited a PhD, or spoke on behalf of an established pharmaceutical company; the public demands random nouns and middle initials, and will settle for nothing less.

The Generator's Spammer Name is: Chapman R. Royalty.

[ Spammer Name Generator [

Goth Lyric Generator.

Create your own Goth Lyrics.

Serpents cling to blackened brilliance
Prayers swell with yearning rapture
Fire eviscerates beloved minions
Agony engulfs feral concubine

[ Goth Lyric Generator ]

Computer Programmers Nickname Generator.

Need and easy way to generate nicknames for the computer programmers in your office? This Computer Programmers Nickname Generator uses a simple javascript routine to generate a random nickname from an array based on the content of your real name.

The Generator is not a Computer Programmer, but if he were, his nickname would be" The Gangster of Code.

[ Computer Programmers Nickname Generator ]

Rap Star Name Generator.

Whether you like the old school hip-hop of 'Rapper's Delight' by the Sugarhill Gang, or the 'gangsta' rap of 50 Cent, one theme plays out: great hip-hop rap star names. Even if you think Ja Rule is 'Ja Crap' or Old Dirty Bastard lacks finesse, an urban styled hip hop name is fun for the whole family.

The Generator's Rap Star Name is The Rhyme .

[ Rap Star Name Generator ]

Lorem Ipsum Generator.

Another 'Lorem Ipsum Generator,' but a very comprehensive one. You can choose between various languages and charsets like, Arabic, Chinese, Greek, Hindi, Cyrillic, L33tspeak, Esperanto, Interlingua, Slovio, Sona, Japanese and more.

Here's a 'Lorem Ipsum' in Lëtzebuergesch, the language spoken in Luxemburg.

Räich ugedon schéinen an zwé. Vun eise Biereg duurch si, hin jo Wisen Poufank, drem gudden bessert dé méi. Wa gin Hunn Blieder. Hir eise jéngt heescht op, mir no Heck d'Pan d'Vioule.

[ Lorem Ipsum Generator ]

Fridge Message Generator.

Create your own fridge magnet messages.



[ Fridge Message Generator ]

Here's [ another ] one

Text To Speech Generator.

Enter some text, choose a voice, then click the 'speak' button.
Your text will be spoken in UK English, US English, Spanish, German and French.

[ Text To Speech Generator ]

Magical Name Acronym Generator.

Nothing is more important to
a person than their name. It is
a label we are given at birth and
therefore can affect our personality
as we grow up and become individuals.

This generator will take your real name
or blog/journal username and tell you
what each letter of it means about
your personality. The things you
learn about yourself or others
in this test may be important!

[ Magical Name Acronym Generator ]

Nerd Name Generator.

Cast off your mundane name and get a new nerd name.

The Generator's nerd name is: Nigel, the Debian Luser.

[ Nerd Name Generator ]

Ransom Note Generator.

Warning: this is for entertainment purposes only. Do not use it for any illegal activities. The Generator Blog will cooperate with all valid law enforcement requests.

Enter your ransom note text in the box. When done, click 'Generate Ransom Note' and a printable ransom note will be created for you.

[ Ransom Note Generator ]

Spam-O-Matic Generator.

Create your own spam.

DO YOU FEEL UNHAPPY? N0 MORE! those times are over.
GET INSTANT HAPPINESS 100%!!!!
Did you ever think..... it doesnt w0rk!? Now it does!
Read on--GENERATOR2000(TM) this will help you GUARANTEED

Try it for free NOW! JUST $89... too good to be troo?
I thought s0 too ....at first. Try it now. CLICK HERE
www.buy-generator2000.com

[ Spam-O-Matic Generator ]

Associate Degrees of Kevin Bacon Generator.

The 'Six Degrees of Kevin Bacon' is fun. No argument there. The problem, though, is that the game is limited to the tiny but growing fraction of people who have been in one or more major motion pictures. What about the rest of humanity? What game is there for them?

This one. In this game, we can connect anyone, anywhere to Kevin Bacon. Just enter a name and find out how that person fits into the Bacon-oriented world.

The Generator taught 'Da Bump' to Suzette Dibny,
who can't stop thinking about Leonard Fortuitous,
who can't get enough of Betty Hopper,
who who once sang a karaoke version
of 'Islands in the Stream' with Kevin Bacon

[ Associate Degrees of Kevin Bacon Generator ]

Star Wars Title Generator.

Help Mr. Lucas out by suggesting old-school titles for the next Star Wars episode, courtesy of randomness.

Coming to a theatre near you:
Die, Obi-Wan, Die.

[ Star Wars Title Generator ]

George W. Bush Conspiracy Generator.

Want to come up with your own conspiracy theory about George W. Bush? Don't let Al Franken, Michael Moore, and MoveOn.org have all the fun! Use this handy George W. Bush Conspiracy Theory Generator to come up with your own conspiracy theory!

* This tool may not be used to create Democratic presidential candidate speeches!

George W. Bush had Michael Jackson arrested so that Rush Limbaugh and Ann Coulter could upset The French.

[ George W. Bush Conspiracy Generator ]

Elvish Name Generator.

No, not Elvis, Elvish.
You have a secret Elvish name.
Discover it.

The Generator's Elvish name is: Mablung Míriel.

[ Elvish Name Generator ]

Letter Generator.

Here you can learn the parts of a letter and how to write your own letter. Just enter your name and get started...

[ Letter Generator ]

Band Name Generator.

There are a lot of Band Name Generators out there.
This is another one but it also generates a poster.



[ Band Name Generator ]

Word Generator.

Stuck for a word? Need something to adequately describe your day yet doesn't already have some other meaning? Look no further than the random word generator!

By analysing the frequency of pairs of letters in 45,402 different words it is possible to generate new words which don't have any meaning but are reasonably syntactically correct.

The Generator made these new words:

generatoraspocketamentingly, generatorist, generatortiveolem, generatoranswimps, generatorusabety, generatornylonian, generatorbiconjunimatessie

[ Word Generator ]

Insulting Nickname Generator.

The Generator already had a nickname. People call him 'Weirdo.'
But now he has an insulting nickname too.



[ Insulting Nickname Generator ]

Bush Background Generator.

Enter some text and create a Bush Background.



[ Bush Background Generator ]

Star Wars Name Generator.

Find out your Star Wars name.

The Generator's Star Wars name is:
Thege Ligen, Rothonda of None

[ Star Wars Name Generator ]

Gif to Text Generator.

This script takes the URL of a GIF image and converts that GIF image into ASCII text or colored HTML. Not very useful, but pretty cool.

[ Gif to Text Generator ]

Bar Joke Generator.

Exhausted your repertiore of bar jokes? Tired of combing local brewpubs and traffic schools for fresh material?
That's why the Random Bar Joke Generator was created. Each press of the button will deliver another knee-slapper, guaranteed to be hilarious to anyone who's sufficiently sloshed out of their gumboots to not actually be that discriminating.

So this guy walks into a bar. A pig gets close to the guy and says 'Give me a dollar and I'll recite the Carmina Burana from memory.' The guy says 'I'm not a guy, I'm a bum!' The bartender thinks a minute and says 'You owe me ten bucks.'

Um... I don't think I get it.

[ Bar Joke Generator ]

Indian Name Generator.

Just enter some information and hit the button. After the wheels stop spinning you will be presented with a certificate that confirms your new Authentic Indian Name.



[ Indian Name Generator ]

Embedded Media HTML Generator.

You may have viewed web pages that have movies or animations that display within a portion of a web page rather than in a separate application. Animation, audio, video, or other media that is displayed within a web page is known as embedded media.

The Embedded Media HTML Generator has been developed to ease the burden of inserting video and animations into web pages.

[ Embedded Media HTML Generator ]

Astronomical Brainabetizer Generator.

Create your name or that of your website with the help of a Brain Alphabet.



Also available, an Astronomical Alphabet



a Sign Alphabet



[ Astronomical Brainabetizer Generator ]

Cocktail Generator.

With the scienterrific Mixilator, creating a cocktail is as easy as pressing a button. You can let the Mixilator do it all, or, to keep things interesting, you can make personal selections to influence your otherwise random automatic cocktail.

The Generator created this cocktail:

Poole's Foppery Special.
Chill cocktail glass. Prepare as follows:
In cocktail shaker frappe with ice
* 1½ oz Seagram's V.O.
* 1 oz Plymouth gin
* ¾ oz grape juice
* 1 tsp. Malort
* 5 drops Underberg bitters

Pour into cocktail glass. Float a scant spoonful of dark rum on surface of drink.

[ Cocktail Generator ]

Concept Web Generator.

Fill in some information and make your own concept web.

[ Concept Web Generator ]

Proverbs Generator.

Create random proverbs.
Like this one:



[ Proverbs Generator ]

Worksheet Generator.

Now you can create customized worksheets in less than 5 minutes! Choose from several vocabulary and math worksheet templates.

[ Worksheet Generator ]

Professor Poopypants Name Change Generator.

Let Professor Poopypants change your name into a silly one.



The Generator's silly name is: Falafel Lizardbuns.

[ Professor Poopypants Name Change Generator ]

Bushku Generator.

It's Bushku, poppie! A Bushku is a Haiku, cyberpoetry as from the glib lips of the US President. A Bushku uses a 3-5-3 syllable form, 'cause 5-7-5 is too darn complexicated.

dry duh scrubs
small clean vile hopes sing
brave (Help me, Dick!) eels shine

[ Bushku Generator ]

Country Star Name Generator.

It has many styles and genres. Contemporary, Honky-Tonk, Bluegrass, Western, Outlaw, Cowboy, even Progressive. But you probably know and love it as Country music. Whether you gamble on Kenny Rogers or get the blues with Alan Jackson, a great western stage name fits like a great pair of well-worn jeans. Use the Country Star Name Generator to let the redneck in you show.

The Generator's Country Star Name is: Vern Pitts.

[ Country Star Name Generator ]

Fairy Tale Generator.

Create your own Fairy Tale.
The Generator created this one:

I stepped outside with father's boots on, feeling the heaviness of his feet in mine. The people in my country's soil then clawed into his boots and pulled me down until I could no longer breathe in anything but dense thick soil and earthworm particles traveling into my mouth.

The spirits of my land traveled through me as well. They drifted in and out of my body, trading places and laughing, laughing at me and my sad predicament.

[ Fairy Tale Generator ]

Snoop Dogg Shizzolator.

What up, cuz? It's tha Snoopy D-O-double Gizzle in da hizzle. Enter yo trickass url and traaanslate it from tha shizzle to da shiznit, know what I'm sayin?

Take a look at The Generator Blog in shiznit.

[ Snoop Dogg Shizzolator ]

Glitter and Glam Rock Name Generator.

If you've ever dreamed of being Ziggy Stardust or a member of Vixen or Poison, this is for you! Just enter your gender and find out your new Glam Rock Star Name.

The Generator's Glitter and Glam Rock Name is: Jupiter Lippstikk.

[ Glitter and Glam Rock Name Generator ]

AIEEE Generator.

Are you tired of practicing your blank stares for when someone says they need a TCP/IP-based LAN set up and a USB-to-SCSI adapter ASAP? Do you wish you could throw around acronyms with that same casual attitude that pisses you off so much? Here's your chance.

With the Acronym Interaction, Expansion and Extrapolation Engine, you can enter any combination of letters you like and you'll get a handy, technical-sounding, completely made-up phrase that borders on the plausible.

Weblog = Wide Erasable Boolean Line Option Graphics.

[ AIEEE Generator ]

Dossier Sexupifier Generator.

Enter the text of your weak, unconvincing dossier, and have it automatically sexed up in seconds, in just the way that Alistair Campbell wouldn't have done.

The Generator Blog is clearly not about those machines used to change mechanical energy into electrical energy within 45 minutes. It's about software that creates software. Software to play around and have fun with.

[ Dossier Sexupifier Generator ]

Gas Giant Image Generator.

The Gas Giant Image Generator creates images of...um, gas giants.
A gas giant is a large planet that is not composed mostly of rock or other solid matter. Gas giants may still have a rocky or metallic core, but the majority of its mass is in the form of gas.



[ Gas Giant Image Generator ]

Business Proposal Generator.

Ever wondered where all those Nigerian Scam emails you keep getting are coming from? Well, they're not coming from here, I can tell you that. But using the Business Proposal Generator, you can come up with your own, including some combinations that even these con men never imagined.

Dear Sir,
My name is Chuichui Todescu, and I am the Cousin of Mr. Chuichui C., the recently Deceased Chairman of the National Bank in Nigeria. If you have been following the events in my country over the last few years, you will remember the big scandal that took place when Mr. C. was found dead in an alley, from an alledged overdose of Tylenol Flu.

As your name was brought to my attention by a very trusted contact in Nigeria's Foreign Office, I have been authorized by my partners to contact you with this Proposal. All that would be required of you is the use of your bank account to perform a transfer of TEN MILLION ($10000000) U.S. Dollars. I am authorized by my Cousin's estate in Nigeria to offer you TWO MILLION FIVE HUNDRED THOUSAND DOLLARS ($2500000) as a compensation for your services.

[ Business Proposal Generator ]

Mr. T Name Generator.

No web trend is complete without involvement by Mr. T, so provide some information and start talking like a hella strong badass.

The Generator's Mr. T Name is: Fool.

[ Mr. T Name Generator ]

Bridge Hand Generator.

The playBridge Hand Generator is a bridge training and education tool. Use one of three available generator screens and playBridge will shuffle and deal for you.
Use it to practice bidding with your partner, to visualize hands, to resolve what-if situations or to produce pre-filled duplicate forms.

[ Bridge Hand Generator ]

Candy Hearts Generator.

To celebrate Valentine's Day, here's another Candy Hearts Generator.



[ Candy Hearts Generator ]

Cyborg Name Generator.

A cyborg, short for CYBernetic ORGanism, is a human being whose body has been taken over in whole or in part by electromechanical devices.

The Generator is a General Electronic Nocturnal Exploration Replicant/Android Trained for Observation and Repair.



[ Cyborg Name Generator ]

(via Corpus Mmothra)

Brad Pitt Consolation Letter Generator.

Brad Pitt is very sad right now and needs the support of his fans while he goes through his difficult and very public breakup with Jennifer Aniston. Write a consolation letter to good old Bradley and try to heal his pain.

[ The Brad Pitt Consolation Letter Generator ]

Jennifer Aniston Consolation Letter Generator.

Jennifer Aniston is very sad right now and needs the support of her fans while she goes through her difficult and very public breakup with Brad Pitt. Write a consolation letter to this recently single hottie good old Jen and try to heal her pain.

[ The Jennifer Aniston Consolation Letter Generator ]

Name Meaning Generator.

Names. Many of us have them, yet what do they mean?
The Royal Academy of Everything has prepared a complete scientific-linguistic analysis of every name ever. Just fill in a small profile to learn about your name.

Literal meaning of Generator: Acetylcolinase.
History: Celebrated as the first word written with the first pencil invented exactly three hundred years ago next week, the name Generator was originally used to refer to a breed of goose.
Famous Generators:
Generator Toot, who could never shake an early association with the concept of acceptable losses;
Generator Tightbadger, channeller under supernatural influences of the lost consonant of Atlantis;
Generator d'Oaf, ghost-writer of Ming the Merciless's excessively sophisticated autobiography;
Typical Generator motto: 'Some bloke over there said it'd be all right.'

[ Name Meaning Generator ]

Comic Strip Generator.

Here's another Comic Strip Creator.



[ Comic Strip Generator ]

Pirate Speak Generator.

Aye ye scurvy dogs, e'er wanted t' be a pirate? Talk with a deep 'oice, have your usual pedestrian walk replaced by a seaman's swagger? Then it is time you learn t' talk like a pirate.

The Pirate Speak Generator will turn your normal small talk int' that o' a bloodthirsty picaroon. Gar, where can I find a bottle o'rum?

[ Pirate Speak Generator ]

(via Christopher)

Dungeon Generator.

Create your own Dungeons and Dragons random dungeon.
The Generator created this dungeon:



[ Dungeon Generator ]

ESL Idea Generator.

The ESL Idea Generator helps ESL teachers explore new ways of teaching. It consists of a randomly generated list of ideas, activities, and suggestions for teaching. Most are fairly simple and can be used with a minimum of preparation.
If the first idea doesn't suit your needs, try again and maybe you'll find something perfect for today's class.

The ESL Idea Generator suggested this idea:

Inquire to see if your students have any unusual talents (can wiggle their ears, can bark like a dog), and encourage them to demonstrate.

[ ESL Idea Generator ]

(via Catnip & Catnaps)

Text Generator.

Tired of using Lorem Ipsum for dummy text in your latest masterpiece? This text generator has been developed based on years of careful research and is guaranteed to improve even the most lacklustre of designs.

Thunder, thunder, thundercats, Ho! Thundercats are on the move, Thundercats are loose. Feel the magic, hear the roar, Thundercats are loose. Thunder, thunder, thunder, Thundercats! Thunder, thunder, thunder, Thundercats! Thunder, thunder, thunder, Thundercats! Thunder, thunder, thunder, Thundercats! Thundercats!

[ Text Generator ]

Keyword Email Signature Generator.

Do you want to annoy those at Echelon (you know, the organization that watches your every move) with some suspicious words in your email signature?
This generator uses a combination of 1662 words to create random signatures for some gagging fun.

I just send an email and signed like this:

Yours Truly, The Generator. Agencies AIMSX argus bank Broadside Centro Chan DC6 detcord DSNET1 DynCorp E911 Enemy of the St FAS Field Security FSB gchq.gov.uk illuminati incendiary devi IRAN ISCS JAVA JRSC KY-75 lamma MOSSAD MP40 NAIAG NASA niche NSWT P415 PLO r00t RPC SAS SC Shipiro unclassified Uzi

Have to go now, someone's knocking on the door!

[ Keyword Email Signature Generator ]

(via Tommi)

Famous Star Generator.

Get your own star on the walk of fame in Hollywood.



[ Famous Star Generator ]

(via Justin)

Insulting Name Generator.

You think you have friends. You hang out with them, they smile, they're friendly, you get on well together. Well, here's the thing: secretly, deep down, they hate you. All they really want to do is hassle you; reject you; kick you while you're down.
That's what this tool is all about. Type in your name below, and you'll receive an insulting name with which they can harangue you into a painful, early grave.

The Insulting Name Generator called The Generator:
Horsefather Penisbreath.
I think I've never been insulted more in my life.

[ Insulting Name Generator ]

Metal Gear Name Generator.

Surveillance photos have picked up images of a new, deadlier Metal Gear. It's currently undergoing the final stages of testing on a remote island in the Pacific. If this new Metal Gear becomes operational, the world will be in danger once again. We're going to need as many new operatives as we can get.
Input your first and last name below, and you'll be given your code name for this mission. The first part of your code name describes your unique skill or personality, and the second part is your animal designation.

The Generator's code name for this mission will be Archer Donkey.

[ Metal Gear Name Generator ]

(via Eric)

DNA-O-Gram Generator.

DNA (deoxyribonucleic acid) is the primary genetic material in all living organisms. A molecule composed of two complementary strands that are wound around each other in a double helix formation. The strands are connected by base pairs that look like rungs in a ladder.
Now, you can send a message that will be encoded as DNA and you will be given the option to email the encoded message. The message will be accompanied by instructions on how to decode the message.

Here's a message from me to you:

ACGGTACTTCTTGTTGATGGAGACGTCATGGAAG
TAGGCGCTATGCCAGAGCTTATGACGCTTGGACT
TGTACGTGTTGGCGTAATGAACGCGGGCGACGTG

In order to see what it reads you have to go to the 'DNA-O-Gram Generator' site and click on 'Decode a DNA-o-gram.'

[ DNA-O-Gram Generator ]

Mormon Name Generator.

They're a funny old bunch, those latter day saints. Rather than picking names from their heritage, or the Bible, the Utah Mormons tend to make them up. Sometimes they'll combine the parents' names into one (BenDonna, for example).
Other times it's impossible to quite understand what their parents were thinking; names like Zestpool and Zon'tl aren't uncommon.
The Mormon Name Generator will Mormonise your moniker after you've typed in your first name, last name and your gender preference.

The Generator can now can walk the Utah streets and feel absolutely at home within the Mormon social framework with a name like:
Tchae Feramorz.

[ Mormon Name Generator ]

Haiku Generator.

Another Haiku Generator, this time from Mostly Muppet.

fingernail biter
false pretenses fade slowly
sometime very soon

[ Haiku Generator ]

Magic: The Gathering Card Generator.

Ever wonder how the fine folks at Wizards of the Coast come up with all those new cards? Well here's a little peek behind the scenes at one of the tools they use. This little program generates names, casting costs, and rarities for Magic cards. It sometimes comes up with silly names, which is strange, considering that it only uses words from existing cards.



[ Magic: The Gathering Card Generator ]

Website of the Year Award Generator.

It's that time of year when all mankind puts aside its differences and unites in a common pursuit: the making of '10 Best' lists. Cruelly, simple mathematics dictates that most of us will never be on one of these lists. But not any longer. With the handy Automated 'Yankee Fog Website of the Year' award you'll be whisked away to a glorious world where you, yes, you, are more beloved than Google.

This is what they said about The Generator Blog:

If you aren't a regular visitor to The Generator Blog, it's going to be difficult to fully explain just how generally brilliant it is. All I can tell you is, creator The Generator is a genius, and I say that with full knowledge of how sadly devalued the word 'genius' has become. Trust me, in Generator's case, it's an understatement.

[ Website of the Year Award Generator ]

Transparent PNG Generator.

The Transparent PNG Generator is a web application where you can easily create transparent PNG images. These can be used to create cool effects in a variety of ways. This application produces only rectangular images, so it will be used mostly for web page background images, but use it for whatever you like.



[ Transparent PNG Generator ]

Hapax Legomenon Generator.

Apparently, a Hapax Legomenon is a word coined for a single occasion, occurring only once in a given language.

The Generator coined the word uaspluo and he's going to use it next Saturday to confuse his friends. (Yes, The Generator does have some friends).

[ Hapax Legomenon Generator ]

(via Toucans)

Band Name Generator.

Here's another Band Name Generator.

The Generator had a hard time to choose between A Wall of Monkeys and A Sack of Ushers but he finally decided for Jake Stallone and the Abundant Axe Gambit

[ Band Name Generator ]

Dr. Phil Quote Generator.

During these times of trouble and turmoil, nothing sedates a soul or stifles common sense quite like words of wisdom from Dr. Phil. In order to preserve his legacy and allow 24-hour a day access to the wit and wisdom of the Sage of our generation, The Random Dr. Phil Quote Generator will satisfy your 'inner wuss.'

This is what Dr. Phil told The Generator:

You don't need sideburns to act real sassy-like.
You don't need anyone or anything to let me tell you how to live.
You don't need a lesson in astrophysics to wax your elbows.

[ Dr. Phil Quote Generator ]

Biblical Curse Generator.

Lost for a smart remark to see off your enemies? Unable to deliver that killer insult? Put an end to that with the amazing Biblical Curse Generator, which is pre-loaded with blistering put-downs as delivered by Elijah, Jeremiah and other monumentally angry saints.

The Generator summoned this Biblical curse:

Behold, thou shalt have more mother-in-laws than King Solomon, thou lying Girgashite

[ Biblical Curse Generator ]

Color Palette Generator.

You can use this php script to generate a color palette based on an image. You may upload an image, or choose one from the list. If you upload an image, it will be kept on the server and can be used again.

A color palette was created based on this chimp's image:



[ Color Palette Generator ]

Poem Generator.

The Poem Generator dissects texts and creates new texts based on the probabilities of words following each other.

The Generator created this poem:

I am the sun.
For she's more beautiful than thee.
With a girl whose eyes are blue,
flowers age, and so do you!
Presents are open, cake is near,
here comes the birthday fear!

[ Poem Generator ]

Dear John Letter Generator.

Is silly old procrastination keeping you from penning the cold, heartless farewell missive which will finally bring your sad, pathetic, and doomed relationship to long-overdue closure?
The Dear John Letter Generator takes the mind-numbing drudgery of traditionally announcing your significant other's impending abandonment, and replaces it with an easy, fun, and altogether painless interactive experience.

The Generator made this letter:

Dear Passive Aggressive Closet Case,
By the time you read this, I'll be hocking your jewelry. I'm sorry for doing this but, you left me no other choice. I think you're swell, but I don't think we're right for each other. First of all, we're not compatible. You're a Pisces, and I'm vastly superior to you. You like long walks on the beach, you eat mayonnaise-based salads, and enjoy flea markets, and I don't like any of these things. I once asked you what color my eyes are and you said 'Greenish blue-brown.'
But you know what? I still want to be friends. We can totally talk once a year. We had some good times, or so you told me. But please, don't be bitter like last time. That means no holding my parents hostage. And no dissecting my Dalmatian.
Peace Out,
The Generator

[ Dear John Letter Generator ]

Frog Generator.

There are all kind of frogs.
There are big frogs, dwarf frogs, tree frogs, poisonous frogs, you name it.
But did you know there are also Random Frogs?

Don't believe me?
Use The Frog Generator and it'll show you a Random Frog.

It showed me this funny fellow:



He looks almost like me!

[ Frog Generator ]

Music Genre Name Generator.

If you're a modern musician, you're probably all too familiar with one of the toughest challenges facing today's aspiring artists. That's right, I'm talking about choosing a musical genre. If you don't select the correct pigeonhole in which to voluntarily confine yourself, how will the record stores know where to stock your album? How will the kids know whether they're supposed to like you?

You can get around this quandry by the same method hundreds of other bands have: you can invent your own genre. And with the Music Genre Name Generator, it's a snap!

The Generator just invented: Emo Opera

[ Music Genre Name Generator ]

Giant Battle Monsters Generator.

Enter your name and that of an opponent and battle away.
The Generator decided to battle... you!

The Generator is a Giant Lizard that spits Ice, Glows in the Dark, cowers from Radiation, and is Covered in Spines and Blind. Strength: 5, Agility: 2, Intelligence: 4.

You are a Human-Sized Man-Eating Plant that eats Rocks, kidnaps Blonde Women, looks like a Man in a Rubber Suit, and has Very Sharp Fangs and Acid for Blood. Strength: 6, Agility: 2, Intelligence: 4.

And the winner is: It's a tie!

[ Giant Battle Monsters Generator ]

Band Name Generator.

Generate random names using an extensive database of hand-selected words. Use these names for a band, song, pet, or just a good laugh. If you like, type in your own word or phrase and the Band Name Generator will randomly use that in the generation process.

The Generator typed in 'Generator' and got these band names:

Atomic Generator, Generator Virtue, Crooked Generator of the Versatile Decade, Generator Tilt, Dental Generator and the Balloon, Dawn Generator, Generator Dream, Generator Daze and the Wanking Distortion.

[ Band Name Generator ]

Hobbit Name Generator.

You have a secret Hobbit name.
Discover it!

The Generator's Hobbit name is Togo Toadfoot of Frogmorton

[ Hobbit Name Generator ]

British Movie Titles Generator.

Type in a word and get your own British Movie Title.



[ British Movie Titles Generator ]

Hockey Name Generator.

Hockey is known for speed, intensity, and a long tradition of silly, tongue-abusing names. You need to be fluent in six languages in order to read through a friggin' roster. So, forget working on your slapshot or sharpening your skate blades, before you don a jersey you need to secure yourself a puck-worthy handle, eh?

The Generator's Canadian Hockey Name is Dougie McGeneratorson
His French-Canadian Hockey Name is Patrick La Generatorieux
And his Russian Hockey Name is Slava Generatorov

[ Hockey Name Generator ]

Label Generator.

Make your own label.



[ Label Generator ]

Spam Generator.

Make your own Spam Message. The Spam Generator takes some words and then generates random sentences based on word probabilities.

The Generator created this nonsense Spam Message:

It's an Internet, the media Drug store again; that burning fat, without notice. You can take advantage of the lady gave at it's FREE last name in plain packaging and for you! Members click here! There is holding steady at rallied no other mailings, are required.

[ Spam Generator ]

English Language Extender Generator.

This generator makes new words out of prefixes, suffixes and root words that it finds lying around. You can also supply your own root word, if you have a word that you really like, and would like to be able to fit it into more conversations.

The Generator created these new words:

generatorary - of or relating to generator
generatorize - to cause to be or to become generator
generatorive - performing or tending toward generator
foregeneratorant - being, promoting or causing before or in front of generator
generatorist - one that performs, produces or believes in generator
misgeneratorness - state, quality, condition or degree of less, wrong generator

[ English Language Extender Generator ]

Barcode Generator.

Generate a printable and scannable barcode in Interleaved 2 of 5, Code 39, Code 128 A, B, or C symbologies.



[ Barcode Generator ]

Drink-O-Meter Generator.

Have you ever wondered just quite how much you've managed yo drink in your lifetime? Or how much it might have cost you? With the Drink-O-Meter you can test the state of your kidneys, wallet and quantity of alcohol you have consumed over the years.

The Drink-O-Meter says The Generator has consumed 1936 drinks. The amount of money spent was $7746. With this result 5.66 bath tubs could be filled and I could buy 0.04 Ferrari's.
Hm, strange, since the Generator doesn't consume any alcohol at all.

[ Drink-O-Meter Generator ]

Country Western Song Generator.

Create your own lyrics for Country and Western songs.
The Generator created this song:

I met her in Sheboygan ridin' shotgun;
I can still recall that little hat she wore;
She was weighted down with Twinkies near Poughkeepsie,
and I knew I'd never rate her more than '4';
I told her shrink I'd punch her out forever;
She said to me her basset hound was shy;
But who'd have thought she'd grovel on her 'Workmate';
She freaked out on the lawn and screamed goodbye.

[ Country Western Song Generator ]

Hogwarts House Generator.

Forget all that zodiac stuff. If you've ever read any of the Harry Potter books, you'll know that the true evaluation of your character is which of the houses at Hogwarts Academy you belong to.



The Generator belongs to the House of Gryffindor.

[ Hogwarts House Generator ]

Super-Hero Generator.

You've decided to take the plunge. You're going to become... a super-hero! Congratulations, but have you worked out the details? What will you call yourself? What weapon will you use in your fight against crime? What kind of transportation will you have? How will you get your powers?

Well, stop worrying! All the answers are right here.
The Generator created this Super-Hero:

Name: Chameleon Rtq'pore
Powers: Super spelling, Heat generation
Source of powers: Extra-terrestrial mutant radiation
Weapon: Chameleon Lasso
Transportation: Chameleon Kayak

[ Super-Hero Generator ]

Michael Jackson Mug Shot Generator.

Poor Michael Jackson. Everbody's making fun of him. Well, not everybody. The Generator doesn't.
The Generator loves Michael Jackson.



[ Michael Jackson Mug Shot Generator ]

Louis Farrakhan African Name Generator.

Enter the white man's label from which you wish to unshackle yourself and a true name for our brothers and sisters shall be granted to you.

From this day forward, The Generator shall be known by all his brothers and sisters as: Buckwheat

[ Louis Farrakhan African Name Generator ]

Monster Pitch Generator.

Ever seen a trailer for a new horror movie and thought 'Damn, I could come up with something better than that.' Here's your chance to create the ultimate horror movie. Then sit back and enjoy your very own movie pitch!

The Generator created this movie plot:

Pjotr Iscary stars as Seagull Man, half seagull, half man. When Professor Kitsy Bungess (Luanna Ghastly) accidentally created seagull man in her laboratory in the sleepy little town of Oppression, California, she shunted his romantic advances.
That hurt Seagull Man, and he has vowed revenge on Kitsy, Oppression, and all of humanity! As Seagull Man attempts to make the Earth a man-free zone, only Professor Bungess and her partially blind great uncle Roger (Heinz Furchterregend) can stop him! Feel the excitement! Witness the brutality! Fear the birds! Don't miss 'The Revenge of Seagull Man,' your life may never be the same!

[ Monster Pitch Generator ]

Lorem Ipsum Generator.

Lorem Ipsum has been the industry's standard dummy text ever since the 1500s, when an unknown printer took a galley of type and scrambled it to make a type specimen book. It has survived not only five centuries, but also the leap into electronic typesetting, remaining essentially unchanged.

Lorem ipsum dolor sit amet, consectetuer adipiscing elit. In hendrerit augue vitae metus. Nunc hendrerit rhoncus tellus. Mauris aliquam iaculis ligula. Vivamus sodales accumsan enim. Morbi eget quam a felis mattis vehicula. Donec erat pede, eleifend viverra, aliquam eu, luctus.

[ Lorem Ipsum Generator ]

Here's [ another ] one

Conspiracy Generator.

Having trouble keeping up with the latest conspiracy theory floating around cyberspace? Then why not make your own? It's never been easier to become a Net nutcase than with the Internet Conspiracy Generator.

The Generator was told:

It is rumored that George Bush was seen aboard the Mir just before the plaintive howl while receiving a case of Heisman trophies implicating involvement in a sinister scheme designed to live long and prosper.

[ Conspiracy Generator ]

Pimp Name Generator.

One of the things most hype about being an elevated player is having a name that mothafuckas respect. It's that one thing that punks who don't have your money always remember to yell while you're beating them down.


The Generator's pimp name is Mack Master T. Flava.

[ Pimp Name Generator ]

Hacker Handle Generator.

Wanna be a hacker? Don't have a handle? Wanna quit fakin' the funk like Joey from Hackers? Tired of your old, busted assed handle?
Type in your name or current handle into the Hacker Handle Generator and get some of the new hotness.

The Generator used to be a hacker that went with the name 'Headbanger.' Now, The Hacker Handle Generator tells him to use the moniker:

Parallel Maniac.

[ Hacker Handle Generator ]

SpamAssassin Configuration Generator.

This tool is designed to make it easier to customize an installation of SpamAssassin with some common options. After you answer some questions, a SpamAssassin configuration file matching your choices will be displayed, and you can download it and use it with your SpamAssassin installation. This is designed to work with SpamAssassin 2.5x only.

[ SpamAssassin Configuration Generator ]